Top » Catalog » SNPs » FGC1

$19.00

FGC1
[FGC1]

FGC1
hg38 Position: ChrY:13111626..13111626
Ancestral: C
Derived: T
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: J1a2b2a~
Comments: .
Forward Primer: FGC1_F CACTGAGTAACTGTCTTTGTTTCTCG
Reverse Primer: FGC1_R CTCCATCCCTGGTTCCAC
Reviews

Customers who bought this product also purchased
FTB22281
FTB22281
Y369484
Y369484
Y87742
Y87742
A27207
A27207
FGC5428
FGC5428
ZS5613
ZS5613
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies