Top » Catalog » SNPs » FGC31784

$18.00

FGC31784
[FGC31784]

FGC31784
hg38 Position: ChrY:11918712..11918712
Ancestral: C
Derived: G
Reference: Full Genomes (2015)
ISOGG Haplogroup: R1b (not listed)
Comments: .
Forward Primer: FGC31784_F AGGTGTTCTGAACCTCTCCAAG
Reverse Primer: FGC31784_R AGACCAGGTTGCGAGTCTTC
Reviews

Customers who bought this product also purchased
FGC19428
FGC19428
FGC23336
FGC23336
FGC33208
FGC33208
FGC19440
FGC19440
FGC31787
FGC31787
FGC23330
FGC23330
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies