Top » Catalog » SNPs » FGC31786

$18.00

FGC31786
[FGC31786]

FGC31786
hg38 Position: ChrY:7289765..7289765
Ancestral: T
Derived: C
Reference: Full Genomes (2015)
ISOGG Haplogroup: R1b (not listed)
Comments: .
Forward Primer: FGC31786_F CAAAAGAGCACGATTCTGAAAC
Reverse Primer: FGC31786_R AACCCCTGGTCTCAAGCC
Reviews

Customers who bought this product also purchased
FGC19447
FGC19447
FGC32876
FGC32876
FGC23332
FGC23332
FGC32881
FGC32881
FGC33208
FGC33208
FGC19432
FGC19432
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies