Top » Catalog » SNPs » M410

$19.00

M410
[M410]

M410
hg38 Position: ChrY:2883637..2883637
Ancestral: A
Derived: G
Reference: Sengupta et al. 2006
ISOGG Haplogroup: J2a
Comments: .
Forward Primer: M410_F TCATTGACCTTAAGTCTGAGTCCC
Reverse Primer: M410_R ACTGGATACCTTTCTAGGAAGAATTG
Reviews

Customers who bought this product also purchased
BY104110
BY104110
PF5033
PF5033
FGC4269
FGC4269
BY60858
BY60858
Z1297
Z1297
Z38299
Z38299
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies