Top » Catalog » Y SNPs » L26

$18.00

L26
[L26]

L26
hg38 Position: ChrY:20781011..20781011
Ancestral: T
Derived: C
Reference: Thomas Krahn (FTDNA)
ISOGG Haplogroup: J2a1
Comments: .
Forward Primer: L26_F GCATGTGTGTTTTGGTGGAG
Reverse Primer: L26_R TCCTTGAGGGTCAGAGGAAG
Reviews (1)

Customers who bought this product also purchased
BY149182
BY149182
FGC15850
FGC15850
Z7515
Z7515
V13
V13
A31137
A31137
FT198500
FT198500
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x L26
$18.00
Haplogroup Info
Other products
Currencies