Top » Catalog » SNPs » S5520

$18.00

S5520
[S5520]

S5520
hg38 Position: ChrY:16923829..16923829
Ancestral: G
Derived: A
Reference: Jim Wilson (2014)
ISOGG Haplogroup: R1b1a1a2a1a1c1b
Comments: Branching predominantly isles
Forward Primer: S5520_F TGAGCACCAATATGCCATTC
Reverse Primer: S5520_R TCTCCCATCTCAGCCTCTTG
Reviews

Customers who bought this product also purchased
Y18100
Y18100
S1911
S1911
A9580
A9580
FGC39806
FGC39806
L51
L51
S3311
S3311
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies