Top » Catalog » SNPs » S5520

$18.00

S5520
[S5520]

S5520
hg38 Position: ChrY:16923829..16923829
Ancestral: G
Derived: A
Reference: Jim Wilson (2014)
ISOGG Haplogroup: R1b1a1a2a1a1c1b
Comments: Branching predominantly isles
Forward Primer: S5520_F TGAGCACCAATATGCCATTC
Reverse Primer: S5520_R TCTCCCATCTCAGCCTCTTG
Reviews

Customers who bought this product also purchased
A9580
A9580
Y18100
Y18100
S1911
S1911
FGC39806
FGC39806
*TOP* - Top-Level Orientation Panel
*TOP* - Top-Level Orientation Panel
P312
P312
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies