Top » Catalog » SNPs » S5556

$18.00

S5556
[S5556]

S5556
hg38 Position: ChrY:22223757..22223757
Ancestral: A
Derived: G
Reference: Jim Wilson (2014)
ISOGG Haplogroup: R1b1a1a2a1a1c1b1
Comments: Branching predominantly isles
Forward Primer: S5556_F GGAGGCTGACAGAAGAAGGTG
Reverse Primer: S5556_R ACAATGTAGTTGGGTGGCG
Reviews

Customers who bought this product also purchased
S3311
S3311
FGC39801
FGC39801
Y18100
Y18100
Z306
Z306
S1911
S1911
A9580
A9580
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies