Top » Catalog » SNPs » A5586

$18.00

A5586
[A5586]

A5586
hg38 Position: ChrY:16629176..16629176
Ancestral: C
Derived: T
Reference: Paul Mize (2015)
ISOGG Haplogroup: R1b (not listed)
Comments: Below P312
Forward Primer: A5586_F GTTTTCTGGCTTCATCCCTC
Reverse Primer: A5586_R ACAAAGATGTCTCATCGGCA
Reviews

Customers who bought this product also purchased
A789
A789
A788
A788
R1b-DF27 Rucker Panel
R1b-DF27 Rucker Panel
A431
A431
A5584
A5584
DNA Sample Kit
DNA Sample Kit
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies