Top » Catalog » SNPs » FGC33208

$18.00

FGC33208
[FGC33208]

FGC33208
hg38 Position: ChrY:8659163..8659163
Ancestral: A
Derived: G
Reference: Full Genomes (2015)
ISOGG Haplogroup: R1b1a2a1a2c1 (not listed)
Comments: Below S1051
Forward Primer: FGC33208v2_F GAGAAACTGCTGGGCTGC
Reverse Primer: FGC33208v2_R GTGAGGGGATCTGAGGAAAAC
Reviews

Customers who bought this product also purchased
FGC19434
FGC19434
FGC23339
FGC23339
FGC33211
FGC33211
FGC19451
FGC19451
FGC32876
FGC32876
R1b-S1051 Mid Argyll Dal Riata Panel
R1b-S1051 Mid Argyll Dal Riata Panel
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies