Top » Catalog » SNPs » L1193

$18.00

L1193
[L1193]

L1193
hg38 Position: ChrY:9610875..9610875
Ancestral: C
Derived: A
Reference: Thomas Krahn (FTDNA)
ISOGG Haplogroup: I2a2a1a1a2
Comments: Found in a hg I-M223 WTY participant
Forward Primer: L1193_F TCTCCTTTTTCAGATCAGCTTCTC
Reverse Primer: L1193_R GTGTTCAGAAAATGTGACTCAACC
Reviews

Customers who bought this product also purchased
DF105
DF105
FGC15072
FGC15072
M9
M9
M223
M223
R1b-DF49 (including M222) North West Irish Panel
R1b-DF49 (including M222) North West Irish Panel
S9403
S9403
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies