Top » Catalog » SNPs » A109

$17.50

A109
[A109]

A109
HG19 Position: ChrY:21900982..21900982
Ancestral: T
Derived: C
Reference: Stewart (2014)
ISOGG Haplogroup: R1b1a2a1a2c1i1 (not listed)
Comments: Found in 2 persons of the 1013 cluster
Forward Primer: A109_F CTGCTCTGTCTTGCCTTTCC
Reverse Primer: A109_R TCTCCCTCTACAGCCTTTGG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies