Top » Catalog » SNPs » Z138

$18.00

Z138
[Z138]

Z138
hg38 Position: ChrY:13599460..13599460
Ancestral: C
Derived: G
Reference: http://dna-forums.org/
ISOGG Haplogroup: I1a2b
Comments: downstream of I1. parallel to L22
Forward Primer: Z138_F GGGAAAGGCCTTGAAGTCAC
Reverse Primer: Z138_R CTCACATTAAGGGCATGCTG
Reviews

Customers who bought this product also purchased
Y18311
Y18311
A11280
A11280
A5644
A5644
A11278
A11278
Y46501
Y46501
A14157
A14157
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies