Top » Catalog » SNPs » YP386

$18.00

YP386
[YP386]

YP386
hg38 Position: ChrY:12943003..12943003
Ancestral: C
Derived: A
Reference: R1a community
ISOGG Haplogroup: R1a1a1b1a3a1b
Comments: .
Forward Primer: YP386_F GCCAGTGCCTATAGGGCTG
Reverse Primer: YP386_R TTTTTTTTGAGATGGAGTCTCACTG
Reviews

Customers who bought this product also purchased
M9
M9
Z282
Z282
Y83617
Y83617
*TOP* - Top-Level Orientation Panel
*TOP* - Top-Level Orientation Panel
L145
L145
BY30614
BY30614
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies