Top » Catalog » SNPs » A1161

$18.00

A1161
[A1161]

A1161
hg38 Position: ChrY:12023565..12023565
Ancestral: T
Derived: C
Reference: David R Moore (2014)
ISOGG Haplogroup: R1b1a2a1a2c1g2a1a3a (not listed)
Comments: Below L1402
Forward Primer: A1161_F GGGCACTTAGGAAGGAGAATTG
Reverse Primer: A1161_R GATGTTGAGCTATGCAAAGGAC
Reviews

Customers who bought this product also purchased
A1162
A1162
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies