Top » Catalog » SNPs » A1162

$19.00

A1162
[A1162]

A1162
hg38 Position: ChrY:13672227..13672227
Ancestral: T
Derived: G
Reference: David R Moore (2014)
ISOGG Haplogroup: R1b1a2a1a2c1g2a1a3a (not listed)
Comments: Below L1402
Forward Primer: A1162_F TTGAAACTTCACCAACATCACC
Reverse Primer: A1162_R CACACTGCTGTGTCTGCCAG
Reviews

Customers who bought this product also purchased
A1161
A1161
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Currencies