Top » Catalog » SNPs » Z2035

$18.00

Z2035
[Z2035]

Z2035
hg38 Position: ChrY:8208399..8208399
Ancestral: G
Derived: T
Reference: Ray Banks (2015)
ISOGG Haplogroup: R1a (not listed)
Comments: Downstream S3477
Forward Primer: Z2035_F GGGTCCTGGTCCCTCG
Reverse Primer: Z2035_R CAGAATGGTTCACTGTTCTGC
Reviews

Customers who bought this product also purchased
M2747
M2747
YP547
YP547
S3485
S3485
S2869
S2869
S3477
S3477
S2894
S2894
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies