Top » Catalog » SNPs » M267

$18.00

M267
[M267]

M267
hg38 Position: ChrY:20579932..20579932
Ancestral: T
Derived: G
Reference: Underhill et al.
ISOGG Haplogroup: J1
Comments: Aka. F4320
Forward Primer: M267v2_F GGTGTTTAAAGAGGATGGACAAG
Reverse Primer: M267v2_R TTTGTAGAGACACGGTTGTACCC
Reviews

Customers who bought this product also purchased
M522
M522
ZS2010
ZS2010
FGC1695
FGC1695
FGC11
FGC11
Z1853
Z1853
Z1865
Z1865
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Haplogroup Info
Other products
Currencies