Top » Catalog » SNPs » M267

$18.00

M267
[M267]

M267
hg38 Position: ChrY:20579932..20579932
Ancestral: T
Derived: G
Reference: Underhill et al.
ISOGG Haplogroup: J1
Comments: Aka. F4320
Forward Primer: M267v2_F GGTGTTTAAAGAGGATGGACAAG
Reverse Primer: M267v2_R TTTGTAGAGACACGGTTGTACCC
Reviews (1)

Customers who bought this product also purchased
CTS2754
CTS2754
M4670
M4670
Y4971
Y4971
L791
L791
Y2933
Y2933
PF5125
PF5125
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies