Top » Catalog » SNPs » M267

$18.00

M267
[M267]

M267
hg38 Position: ChrY:20579932..20579932
Ancestral: T
Derived: G
Reference: Underhill et al.
ISOGG Haplogroup: J1
Comments: Aka. F4320
Forward Primer: M267v2_F GGTGTTTAAAGAGGATGGACAAG
Reverse Primer: M267v2_R TTTGTAGAGACACGGTTGTACCC
Reviews

Customers who bought this product also purchased
DNA Sample Kit
DNA Sample Kit
L1425
L1425
ZS3546
ZS3546
ZS55
ZS55
CTS3068
CTS3068
F1614
F1614
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Haplogroup Info
Other products
Currencies