Top » Catalog » SNPs » A6268

$18.00

A6268
[A6268]

A6268
hg38 Position: ChrY:12489115..12489115
Ancestral: C
Derived: T
Reference: William Davison (2015)
ISOGG Haplogroup: R1b (not listed)
Comments: .
Forward Primer: A6268_F ATGCTTCCGAGTTGCATTG
Reverse Primer: A6268_R TGCTGCAGACACATTCATTAGG
Reviews

Customers who bought this product also purchased
A6272
A6272
A6276
A6276
A6270
A6270
A6275
A6275
A6269
A6269
A6273
A6273
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies