Top » Catalog » SNPs » A6269

$18.00

A6269
[A6269]

A6269
hg38 Position: ChrY:13569707..13569707
Ancestral: C
Derived: A
Reference: William Davison (2015)
ISOGG Haplogroup: R1b (not listed)
Comments: .
Forward Primer: A6269_F ATGGCATTTTGCTGGTTTTC
Reverse Primer: A6269_R AAAGAGCACAAAGCCAGAGG
Reviews

Customers who bought this product also purchased
A6274
A6274
A6271
A6271
A6277
A6277
A6272
A6272
A6276
A6276
A6270
A6270
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies