Top » Catalog » SNPs » A6276

$18.00

A6276
[A6276]

A6276
hg38 Position: ChrY:8450751..8450751
Ancestral: G
Derived: A
Reference: William Davison (2015)
ISOGG Haplogroup: R1b (not listed)
Comments: .
Forward Primer: A6276_F CCCACTTGCTTGCCACC
Reverse Primer: A6276_R GAGAGTCATGTCATTTGCATGC
Reviews

Customers who bought this product also purchased
A6271
A6271
A6272
A6272
A6277
A6277
A6270
A6270
A6275
A6275
A6269
A6269
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies