Top » Catalog » SNPs » ZS8352

$18.00

ZS8352
[ZS8352]

ZS8352
hg38 Position: ChrY:19099589..19099589
Ancestral: C
Derived: G
Reference: Victar Mas (2015)
ISOGG Haplogroup: J1
Comments: Downstream FGC4474
Forward Primer: ZS8352_F AAATAAAACACTCACTTCAGGATATCG
Reverse Primer: ZS8352_R AAAGTAGGGAGGTCTTGCTGG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies