Top » Catalog » SNPs » Y177575

$19.00

Y177575
[Y177575]

Y177575
hg38 Position: ChrY:15571797..15571797
Ancestral: G
Derived: A
Reference: YFull (2018)
ISOGG Haplogroup: I2
Comments: Below L38 > PH1237 > Y125026
Forward Primer: Y177575_F GGTGTATGAGAATGCTTGTGATTG
Reverse Primer: Y177575_R GCGTCTGTTCATATCCTTCGG
Reviews

Customers who bought this product also purchased
A577
A577
M253
M253
Y125026
Y125026
Z59
Z59
Y31038
Y31038
Z2336
Z2336
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Currencies