Top » Catalog » SNPs » CTS9320

$19.00

CTS9320
[CTS9320]

CTS9320
hg38 Position: ChrY:16708309..16708309
Ancestral: T
Derived: C
Reference: Chris Tyler-Smith (2011)
ISOGG Haplogroup: E1b1b1a1b1a1 (not listed)
Comments: Approx. E-M35.2; downstream PF2217
Forward Primer: CTS9320_F ATTATTGTTAACTATAATTTCCCTGCTATACTATC
Reverse Primer: CTS9320_R TCATTTAAATTTACTTAAATGTATTATGCTAGTG
Reviews

Customers who bought this product also purchased
Y253015
Y253015
Y188826
Y188826
Y189173
Y189173
BY14151
BY14151
CTS1273
CTS1273
Y142958
Y142958
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Currencies