Top » Catalog » SNPs » Y197097

$19.00

Y197097
[Y197097]

Y197097
hg38 Position: ChrY:10048027..10048027
Ancestral: C
Derived: G
Reference: YFull (2020)
ISOGG Haplogroup: I2
Comments: .
Forward Primer: Y197097_F TGGCCAGGATACAGTTTTGC
Reverse Primer: Y197097_R TCCACTACTCTTGACTCCCTCTTAC
Reviews

Customers who bought this product also purchased
Y196998
Y196998
Y196971
Y196971
Y196220
Y196220
FT25907
FT25907
Y196599
Y196599
I2-Y56203-Herzegovina
I2-Y56203-Herzegovina
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Currencies