Top » Catalog » SNPs » FT170034

$18.00

FT170034
[FT170034]

FT170034
hg38 Position: ChrY:16134863..16134863
Ancestral: C
Derived: T
Reference: FTDNA (2019)
ISOGG Haplogroup: I2
Comments: Below PH908 > FT16449 > Y126296 > Y81557
Forward Primer: FT170034_F ATCCTTAAGCTTCCAGAGCAAATAC
Reverse Primer: FT170034_R TCATGAGACTTATTCATTATTTGAGAATGT
Reviews

Customers who bought this product also purchased
FT168912
FT168912
FT167267
FT167267
I2-PH908_Y81557 Sremac Panel
I2-PH908_Y81557 Sremac Panel
FT167234
FT167234
FT165387
FT165387
FT167865
FT167865
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies