Top » Catalog » SNPs » FT287915

$18.00

FT287915
[FT287915]

FT287915
hg38 Position: ChrY:8938758..8938758
Ancestral: C
Derived: T
Reference: FTDNA (2020)
ISOGG Haplogroup: R1a
Comments: Below M458 > L1029 > YP728 > YP6047
Forward Primer: FT287915_F GCCAGCATGAGTTCTGGC
Reverse Primer: FT287915_R CTAGACAGAGAGTGCTGATTGTTGTAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies