Top » Catalog » SNPs » CTS996

$18.00

CTS996
[CTS996]

CTS996
hg38 Position: ChrY:7264574..7264574
Ancestral: C
Derived: T
Reference: Chris Tyler-Smith (2011)
ISOGG Haplogroup: O
Comments: Observed in haplogroups J1-FGC85619 and O-CTS3763
Forward Primer: CTS996_F GCACCCTGTCAAAACTGACTG
Reverse Primer: CTS996_R AGCCTCCTGAGCAGCTAGG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Haplogroup Info
Other products
Currencies