Top » Catalog » SNPs » FGC3917

$19.00

FGC3917
[FGC3917]

FGC3917
hg38 Position: ChrY:11821174..11821174
Ancestral: A
Derived: G
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: R1b
Comments: Below DF21 > DF5 > FGC3911 > FGC3906
Forward Primer: FGC3917_F ACCTCCCAGGTTCAAGCAG
Reverse Primer: FGC3917_R TGGTTTAATCCTTAGATGCATAAAATG
Reviews

Customers who bought this product also purchased
FGC3919
FGC3919
FGC3934
FGC3934
L626
L626
FGC3914
FGC3914
FGC3931
FGC3931
R1b-FGC3911 Comprehensive Test
R1b-FGC3911 Comprehensive Test
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Currencies