Top » Catalog » SNPs » A240

$19.00

A240
[A240]

A240
hg38 Position: ChrY:14293430..14293430
Ancestral: G
Derived: A
Reference: A. P. (2014)
ISOGG Haplogroup: R1b1a2a1a2c1j (not listed)
Comments: Downstream R1b-Z251
Forward Primer: A240_F CTGGGATACCATCAGAAAAATC
Reverse Primer: A240_R CGGGAGTTTTCCTACACAAGC
Reviews

Customers who bought this product also purchased
A975
A975
A959
A959
A980
A980
A958
A958
A979
A979
A977
A977
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Currencies