Top » Catalog » SNPs » FT26831

$18.00

FT26831
[FT26831]

FT26831
hg38 Position: ChrY:21628715..21628715
Ancestral: C
Derived: G
Reference: FTDNA (2019)
ISOGG Haplogroup: R1b
Comments: .
Forward Primer: FT26831_F GGGGCAAAATTAAAATTGCTC
Reverse Primer: FT26831_R AAAATGCCTAGCAAAAATGACG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Haplogroup Info
Other products
Currencies