Top » Catalog » SNPs » Y133702

$18.00

Y133702
[Y133702]

Y133702
hg38 Position: ChrY:16877874..16877874
Ancestral: C
Derived: G
Reference: YFull (2018)
ISOGG Haplogroup: R1b
Comments: .
Forward Primer: Y133702_F GGAGAAACAATGTTGGAACACG
Reverse Primer: Y133702_R TCGAGGGTGGTATGCCC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies