Top » Catalog » SNPs » FT135012

$18.00

FT135012
[FT135012]

FT135012
hg38 Position: ChrY:21675694..21675694
Ancestral: G
Derived: C
Reference: FTDNA (2019)
ISOGG Haplogroup: J1
Comments: Below ZS5809
Forward Primer: FT135012_F TGCAATGCCTCAACTCACTTC
Reverse Primer: FT135012_R GCCTATATGAGCTGTAACACTCACC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies