Top » Catalog » SNPs » Z16500

$18.00

Z16500
[Z16500]

Z16500
hg38 Position: ChrY:15569776..15569776
Ancestral: C
Derived: T
Reference: Alex Williamson (2014)
ISOGG Haplogroup: R1b1a1a2a1a2c1n
Comments: downstream of DF13
Forward Primer: Z16500_F GTGGGGGAAAGGAAGGTATC
Reverse Primer: Z16500_R CTTGGACTTAAACCAGAGGTGAG
Reviews

Customers who bought this product also purchased
L238
L238
U152
U152
DF19
DF19
L20
L20
DF27
DF27
A1105
A1105
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies