Top » Catalog » SNPs » A27504

$19.00

A27504
[A27504]

A27504
hg38 Position: ChrY:7049831..7049831
Ancestral: G
Derived: A
Reference: YSEQ (2020)
ISOGG Haplogroup: R1b
Comments:
Forward Primer: A27504_F GGATCACTGGGTCAAATGGTG
Reverse Primer: A27504_R TGGAATATTCTGGATTCATGGC
Reviews

Customers who bought this product also purchased
A27505
A27505
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Currencies