Top » Catalog » SNPs » MC14

$18.00

MC14
[MC14]

MC14
hg38 Position: ChrY:19563033..19563033
Ancestral: A
Derived: G
Reference: Christopher McCown (2014)
ISOGG Haplogroup: R1b1a2a1a2c1
Comments: Downstream from R1b-DF13
Forward Primer: MC14_F GCCTGGTCTCTGATCTGGTC
Reverse Primer: MC14_R TTTGCTGGGTGAAGGAGAAG
Reviews (1)

Customers who bought this product also purchased
R1b-FGC5494 Panel
R1b-FGC5494 Panel
FGC19915
FGC19915
A7820
A7820
A7254
A7254
A7757
A7757
Y9097
Y9097
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies