Top » Catalog » SNPs » Y2608

$18.00

Y2608
[Y2608]

Y2608
hg38 Position: ChrY:13020370..13020370
Ancestral: T
Derived: C
Reference: Semargl (2013)
ISOGG Haplogroup: R1a1a1b2a2b1a (not listed)
Comments: Aka FGC15010; found from public sources
Forward Primer: Y2608_F CCACTTTAGCCATGCTGGTC
Reverse Primer: Y2608_R TGCCAGGGTAACTGGCTG
Reviews

Customers who bought this product also purchased
BY27373
BY27373
Y2194
Y2194
YP4999
YP4999
Z94
Z94
Z282
Z282
R1a-Z93 Panel
R1a-Z93 Panel
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies