Top » Catalog » SNPs » YP355

$18.00

YP355
[YP355]

YP355
hg38 Position: ChrY:13206634..13206634
Ancestral: T
Derived: A
Reference: YFull (2014)
ISOGG Haplogroup: R1a1a1b1a3a (not listed)
Comments: Downstream of L448. parallel to CTS4179
Forward Primer: YP355_F GCCTGGGATAAGACAGTTGC
Reverse Primer: YP355_R TCGGATGTGTGCATTTTAGC
Reviews

Customers who bought this product also purchased
Y129904
Y129904
M343
M343
L335
L335
Z834
Z834
Y83617
Y83617
BY30614
BY30614
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies