Top » Catalog » SNPs » S19928

$18.00

S19928
[S19928]

S19928
hg38 Position: ChrY:15480796..15480796
Ancestral: G
Derived: A
Reference: Jim Wilson (2014)
ISOGG Haplogroup: E1b1 (not listed)
Comments: .
Forward Primer: S19928_F CCTTGTAATCTACAGGAAAGATTGG
Reverse Primer: S19928_R GAAAACTACAGACAATATAAGCGTTTTTC
Reviews

Customers who bought this product also purchased
BY4574
BY4574
Y161798
Y161798
Y161799
Y161799
Y97307
Y97307
BY4461
BY4461
BY4600
BY4600
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies