Top » Catalog » SNPs » V12

$18.00

V12
[V12]

V12
hg38 Position: ChrY:6955058..6955058
Ancestral: A
Derived: G
Reference: Cruciani et al. (Univ. La Sapienza)
ISOGG Haplogroup: E1b1b1a1a1
Comments: Aka Z1216; TBL1Y region
Forward Primer: V12v2_F CTCTGTGGGAAATTTATTATGCCT
Reverse Primer: V12v2_R TTATGATCCAAGAGGGAGAATAAAG
Reviews

Customers who bought this product also purchased
Y16563
Y16563
PH2818
PH2818
FGC58917
FGC58917
M180
M180
Y33587
Y33587
Y33589
Y33589
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies