Top » Catalog » SNPs » Z16659

$18.00

Z16659
[Z16659]

Z16659
hg38 Position: ChrY:13514203..13514203
Ancestral: A
Derived: C
Reference: Greg Magoon et al. (2014)
ISOGG Haplogroup: E1b1b1a1b1a (not listed)
Comments: downstream from Z5018. Under S2979
Forward Primer: Z16659_F AAGTTGCTGTCAGCTTAAAATGG
Reverse Primer: Z16659_R TTCCTTTTTCCCTTAACTCTTTG
Reviews

Customers who bought this product also purchased
FT91330
FT91330
S25577
S25577
BY5500
BY5500
Y178742
Y178742
L335
L335
Z834
Z834
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies