Top » Catalog » SNPs » FGC13914

18.05€

FGC13914
[FGC13914]

FGC13914
hg38 Position: ChrY:12233886..12233886
Ancestral: C
Derived: T
Reference: Full Genomes Corp. (2016)
ISOGG Haplogroup: R1b1a2a1a2c1j (not listed)
Comments: .
Forward Primer: FGC13914v2_F TTTTTCTTTGTTTGTTGGTTGG
Reverse Primer: FGC13914v2_R CTCCCAAACTGCTGGGATAC
Reviews

Customers who bought this product also purchased
A976
A976
A975
A975
A959
A959
A980
A980
A958
A958
A979
A979
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Currencies