Top » Catalog » SNPs » A275

$19.00

A275
[A275]

A275
hg38 Position: ChrY:11512813..11512813
Ancestral: T
Derived: C
Reference: M. Engelen (2014)
ISOGG Haplogroup: R1b1a2a1a2b (not listed)
Comments: Downstream of R-U152*
Forward Primer: A275_F TGGTCTTCAAAGGAATTTATGG
Reverse Primer: A275_R TACTCCATTCCGATCGGTTC
Reviews

Customers who bought this product also purchased
BY3550
BY3550
CTS4562
CTS4562
FGC6418
FGC6418
A12510
A12510
FGC6511
FGC6511
Y22447
Y22447
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Currencies