Top » Catalog » SNPs » A206

$18.00

A206
[A206]

A206
hg38 Position: ChrY:7309500..7309500
Ancestral: C
Derived: A
Reference: YSEQ (2016)
ISOGG Haplogroup: R1b1a1a2a1a2c1c1b1b1
Comments: Found in a R1b-CTS4466 person
Forward Primer: A206_F TTTGCCACTTGGACACATTG
Reverse Primer: A206_R TGCACAGAAAACACAAAATGC
Reviews

Customers who bought this product also purchased
A218
A218
A352
A352
A338
A338
DYS481
DYS481
A341
A341
A216
A216
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A2188
$18.00
Haplogroup Info
Other products
Currencies