Top » Catalog » SNPs » Z4624

$18.00

Z4624
[Z4624]

Z4624
hg38 Position: ChrY:16042213..16042213
Ancestral: G
Derived: A
Reference: Ray Banks (2015)
ISOGG Haplogroup: H1a1d2c2
Comments: under M82
Forward Primer: Z4624_F AGTCTTGGAAGGGTGTGTGG
Reverse Primer: Z4624_R ACTCAGTGGGCAGGACAATC
Reviews

Customers who bought this product also purchased
Y72918
Y72918
L1029
L1029
Y184194
Y184194
M458
M458
Y2395
Y2395
PF6155
PF6155
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies