Top » Catalog » SNPs » A218

$18.00

A218
[A218]

A218
hg38 Position: ChrY:19899772..19899772
Ancestral: C
Derived: T
Reference: YSEQ (2016)
ISOGG Haplogroup: R1b1a1a2a1a2c1c1b1b
Comments: Found in a R1b-CTS4466 person
Forward Primer: A218_F TAGGGCCTTGGGGAATTTAC
Reverse Primer: A218_R TCAAGGACTTGAACCCCAAG
Reviews

Customers who bought this product also purchased
A206
A206
A347
A347
A216
A216
A352
A352
A338
A338
R1b-A212 McRaney Family Panel
R1b-A212 McRaney Family Panel
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies