Top » Catalog » SNPs » A286

$19.00

A286
[A286]

A286
hg38 Position: ChrY:10067979..10067979
Ancestral: T
Derived: G
Reference: Mike Walsh et al. (2014)
ISOGG Haplogroup: R1b1a1a2a1a2c1c2
Comments: .
Forward Primer: A286_F CAGAGATGAATGGGATGTTTCAC
Reverse Primer: A286_R CCAAGTCACCCCTCCGTG
Reviews

Customers who bought this product also purchased
A12386
A12386
BY23383
BY23383
FGC11304
FGC11304
FGC11272
FGC11272
S1115
S1115
A353
A353
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Currencies