Top » Catalog » SNPs » CTS6739

$18.00

CTS6739
[CTS6739]

CTS6739
hg38 Position: ChrY:14974415..14974415
Ancestral: T
Derived: C
Reference: Chris Tyler-Smith (2011)
ISOGG Haplogroup: I1a2a1a1a1 (not listed)
Comments: Extracted from 1000 genomes data. Not qualified.
Forward Primer: CTS6739_F TTACAGGTGAGAGCGACTGC
Reverse Primer: CTS6739_R TGAGTCCCATTTTTGCCTTC
Reviews

Customers who bought this product also purchased
A1603
A1603
I1-Z140 Panel
I1-Z140 Panel
Y6232
Y6232
A196
A196
BY178134
BY178134
F2642
F2642
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies